Skip to content

Investment Policy

  • Science
  • Analytics
  • Who is Denis Avetisyan?

Science

Signing the Future: Secure, Modifiable Signatures in a Post-Quantum World

25.02.2026 by Ray Dalio

Researchers have developed the first post-quantum sanitizable signature scheme, offering a way to securely alter signed documents without invalidating the signature.

Categories Science

Mapping the Genome’s Building Blocks: A New Approach to String Set Compression

25.02.2026 by Ray Dalio

The study demonstrates that a de Bruijn graph, constructed from a string set-specifically [latex]I=\{X=ACTAGATCCGTTGGCAACTA, ACTAC, CTAGG, TAGAC, AGATA, GATCT, ATCCC, TCCGG, CCGTA, CGTTA, GTTGT, TTGGA, TGGCG, GGCAT, GCAAA, CAACG, AACTT\} [/latex] with [latex] fork=4 [/latex], [latex] k=4 [/latex], and [latex] n=|\Sigma|^{k-2}=4^{2}=16 [/latex]-can yield a concise, closed necklace representation requiring 32 symbols and 32 parentheses (64 characters total), or alternatively, an Euler tig solution generating 80 plaintext characters, highlighting a fundamental tension between representational efficiency and direct textual output.

Researchers have developed a refined method for representing and compressing sets of genomic strings, offering improved efficiency and accuracy in bioinformatics applications.

Categories Science

Hardening Satellites: A New Security Architecture for the AI Era

25.02.2026 by Ray Dalio

As artificial intelligence increasingly powers space-based systems, a robust security framework is critical to protect against evolving threats to satellite infrastructure.

Categories Science

Preserving Scientific Data Integrity Through Smarter Compression

25.02.2026 by Ray Dalio

Quantization introduces errors into data, and the extent of these errors is visually represented, demonstrating the impact of reduced precision.

A new approach minimizes artifacts introduced during lossy compression of scientific datasets, ensuring data quality remains high even with significant size reduction.

Categories Science

Safeguarding Systems: A New Approach to Nonlinear Control

24.02.2026 by Ray Dalio

This research demonstrates that a refined time-driven learning control (rTLC) strategy-evaluated with a time step of [latex]\Delta t = 0.85[/latex] and a discrete time step of [latex]dt = 0.1[/latex]-offers a compelling performance profile in terms of speed, control, and safety, distinguishing itself from traditional time-driven and event-driven learning control approaches.

Researchers have developed a novel control method that enhances the safety and reliability of complex systems by proactively addressing potential hazards.

Categories Science

The Agentic AI Attack Surface: A New Frontier for Cybersecurity

24.02.2026 by Ray Dalio

The agentic runtime operates within a supply loop vulnerable to compromise through manipulation of both data-injecting malicious content into perception sources like context windows and databases-and tools, subverting capability resolution across discovery, implementation, and invocation phases, creating a self-perpetuating cycle where poisoned perception drives unauthorized actions and compromised outputs further contaminate the environment.

As autonomous AI systems become increasingly integrated into software supply chains, a new range of vulnerabilities emerges, demanding a proactive shift in security paradigms.

Categories Science

Mapping Molecular Magnetism with Unprecedented Precision

24.02.2026 by Ray Dalio

The study demonstrates a strong correlation between experimental and computed g-shifts - measured in parts per thousand - across a full benchmark set, achieved through both effective Hamiltonian (EH) and Kramers (K) gg-tensor formalisms when combined with the SO-QDNEVPT2 and SA-CASSCF methods, suggesting a robust computational approach to understanding these subtle quantum phenomena.

A new theoretical approach significantly enhances the accuracy of g-tensor calculations, crucial for understanding the magnetic behavior of molecules.

Categories Science

Breaking the Quantization Bottleneck

24.02.2026 by Ray Dalio

The study demonstrates that while standard vector quantization struggles to maintain representational fidelity with evolving data distributions, adaptive methods-specifically those employing variance-controlled updates and gradient-driven projections-enable codebooks to dynamically track distributional shifts, preserving coverage and overall alignment despite inevitable lagging in a subset of codewords.

New research challenges the assumptions behind vector quantization, offering solutions to a common problem that hinders generative model performance.

Categories Science

Beyond Vector Quantization: A Differentiable Approach to Latent Space Compression

24.02.2026 by Ray Dalio

The proposed PCA-VAE architecture extracts latent features and projects them through a PCA layer-updated via Oja’s rule and running-average but treated as fixed during backpropagation-to facilitate both global and spatially-resolved latent configurations before decoding for reconstruction, effectively managing dimensionality while preserving crucial information for graceful system degradation.

Researchers have developed a new generative model that replaces discrete quantization with a continuous Principal Component Analysis layer, offering improved performance and interpretability.

Categories Science

Quantum Kernels Get a Boost from Spectral Encoding

24.02.2026 by Ray Dalio

Spectral Phase Encoding transforms classical data into quantum states by first mapping it to relative phases in the frequency domain, then embedding those phases via a diagonal gate acting on a uniform superposition, with kernel values ultimately derived through overlap estimation-a process that inherently acknowledges the eventual decay of precise information within the system.

A new approach to constructing quantum kernels using spectral phase encoding demonstrates increased resilience to noise, offering a pathway to more reliable quantum machine learning.

Categories Science
Older posts
Newer posts
← Previous Page1 … Page41 Page42 Page43 … Page155 Next →
© 2026 Investment Policy • Built with GeneratePress