Skip to content

Investment Policy

  • Science
  • Analytics
  • Who is Denis Avetisyan?

Science

Hardening RISC-V Against Power Attacks

25.02.2026 by Ray Dalio

CryptRISC presents a processor architecture deliberately structured to anticipate and mitigate side-channel vulnerabilities, with newly introduced architectural blocks - highlighted for clarity - forming the core of this hardened design and acknowledging the inevitability of future compromise.

A new processor design, CryptRISC, integrates cryptographic acceleration with advanced masking techniques to deliver robust security against side-channel attacks.

Categories Science

Searching the Encrypted World: A Faster Approach to Location-Based Queries

25.02.2026 by Ray Dalio

Spatial-keyword queries, encompassing both range and [latex]22NN[/latex] approaches, demonstrate versatile application across diverse scenarios, highlighting the adaptability of these methods in information retrieval systems.

A new framework efficiently unlocks secure searches over sensitive geo-textual data, balancing privacy with performance.

Categories Science

Signing the Future: Secure, Modifiable Signatures in a Post-Quantum World

25.02.2026 by Ray Dalio

Researchers have developed the first post-quantum sanitizable signature scheme, offering a way to securely alter signed documents without invalidating the signature.

Categories Science

Mapping the Genome’s Building Blocks: A New Approach to String Set Compression

25.02.2026 by Ray Dalio

The study demonstrates that a de Bruijn graph, constructed from a string set-specifically [latex]I=\{X=ACTAGATCCGTTGGCAACTA, ACTAC, CTAGG, TAGAC, AGATA, GATCT, ATCCC, TCCGG, CCGTA, CGTTA, GTTGT, TTGGA, TGGCG, GGCAT, GCAAA, CAACG, AACTT\} [/latex] with [latex] fork=4 [/latex], [latex] k=4 [/latex], and [latex] n=|\Sigma|^{k-2}=4^{2}=16 [/latex]-can yield a concise, closed necklace representation requiring 32 symbols and 32 parentheses (64 characters total), or alternatively, an Euler tig solution generating 80 plaintext characters, highlighting a fundamental tension between representational efficiency and direct textual output.

Researchers have developed a refined method for representing and compressing sets of genomic strings, offering improved efficiency and accuracy in bioinformatics applications.

Categories Science

Hardening Satellites: A New Security Architecture for the AI Era

25.02.2026 by Ray Dalio

As artificial intelligence increasingly powers space-based systems, a robust security framework is critical to protect against evolving threats to satellite infrastructure.

Categories Science

Preserving Scientific Data Integrity Through Smarter Compression

25.02.2026 by Ray Dalio

Quantization introduces errors into data, and the extent of these errors is visually represented, demonstrating the impact of reduced precision.

A new approach minimizes artifacts introduced during lossy compression of scientific datasets, ensuring data quality remains high even with significant size reduction.

Categories Science

Safeguarding Systems: A New Approach to Nonlinear Control

24.02.2026 by Ray Dalio

This research demonstrates that a refined time-driven learning control (rTLC) strategy-evaluated with a time step of [latex]\Delta t = 0.85[/latex] and a discrete time step of [latex]dt = 0.1[/latex]-offers a compelling performance profile in terms of speed, control, and safety, distinguishing itself from traditional time-driven and event-driven learning control approaches.

Researchers have developed a novel control method that enhances the safety and reliability of complex systems by proactively addressing potential hazards.

Categories Science

The Agentic AI Attack Surface: A New Frontier for Cybersecurity

24.02.2026 by Ray Dalio

The agentic runtime operates within a supply loop vulnerable to compromise through manipulation of both data-injecting malicious content into perception sources like context windows and databases-and tools, subverting capability resolution across discovery, implementation, and invocation phases, creating a self-perpetuating cycle where poisoned perception drives unauthorized actions and compromised outputs further contaminate the environment.

As autonomous AI systems become increasingly integrated into software supply chains, a new range of vulnerabilities emerges, demanding a proactive shift in security paradigms.

Categories Science

Mapping Molecular Magnetism with Unprecedented Precision

24.02.2026 by Ray Dalio

The study demonstrates a strong correlation between experimental and computed g-shifts - measured in parts per thousand - across a full benchmark set, achieved through both effective Hamiltonian (EH) and Kramers (K) gg-tensor formalisms when combined with the SO-QDNEVPT2 and SA-CASSCF methods, suggesting a robust computational approach to understanding these subtle quantum phenomena.

A new theoretical approach significantly enhances the accuracy of g-tensor calculations, crucial for understanding the magnetic behavior of molecules.

Categories Science

Breaking the Quantization Bottleneck

24.02.2026 by Ray Dalio

The study demonstrates that while standard vector quantization struggles to maintain representational fidelity with evolving data distributions, adaptive methods-specifically those employing variance-controlled updates and gradient-driven projections-enable codebooks to dynamically track distributional shifts, preserving coverage and overall alignment despite inevitable lagging in a subset of codewords.

New research challenges the assumptions behind vector quantization, offering solutions to a common problem that hinders generative model performance.

Categories Science
Older posts
Newer posts
← Previous Page1 … Page58 Page59 Page60 … Page173 Next →
© 2026 Investment Policy • Built with GeneratePress