![The study demonstrates that a de Bruijn graph, constructed from a string set-specifically [latex]I=\{X=ACTAGATCCGTTGGCAACTA, ACTAC, CTAGG, TAGAC, AGATA, GATCT, ATCCC, TCCGG, CCGTA, CGTTA, GTTGT, TTGGA, TGGCG, GGCAT, GCAAA, CAACG, AACTT\} [/latex] with [latex] fork=4 [/latex], [latex] k=4 [/latex], and [latex] n=|\Sigma|^{k-2}=4^{2}=16 [/latex]-can yield a concise, closed necklace representation requiring 32 symbols and 32 parentheses (64 characters total), or alternatively, an Euler tig solution generating 80 plaintext characters, highlighting a fundamental tension between representational efficiency and direct textual output.](https://arxiv.org/html/2602.19408v1/x2.png)
Researchers have developed a refined method for representing and compressing sets of genomic strings, offering improved efficiency and accuracy in bioinformatics applications.
Slitherine let me know the next developer diary will focus on the Order System. This system is how players will give instructions and direct their units, with each unit having six basic command options.
On February 10th, a major update called Season 1: Conquest was released for Overwatch. The update includes ongoing storylines throughout the year, a redesigned user interface, and five new characters to play. Since this relaunch, the game has been very successful. Then, on February 13th, a quick update was released with adjustments to the five new Season 1 characters, as well as Vendetta, who was added in the previous season.
Many PlayStation 2 games haven’t held up well over time, but a select few still look incredible. A list of the best-looking PS2 games created today would likely be very similar to one made in 2006, because these games were true visual achievements that remain stunning.
Once you begin the “Keeping an Eye Out” quest in ARC Raiders, you’ll need to play on the Blue Gate map and go to the Barren Clearing. It’s on the west side of the map, and you might even start there if you’re lucky. From the Barren Clearing, make your way towards the remains of the broken highway.
According to data from Bloomberg Intelligence – you know, the analysts who actually crunch numbers – the 13F filers, those are the wealthy institutions who need to report their assets to the SEC every quarter, were busy dumping Bitcoin ETFs in Q4 2025, offloading nearly $1.6 billion worth. Quite the ‘oops, maybe we should’ve held on’ moment.
Ethereum [ETH] joined the parade of misery, its fortunes sinking like a lead balloon, all thanks to the timely exit of co-founder Buterin. As these two crypto titans staggered about the marketplace like a pair of drunken sailors, the mood became positively “risk-off.” Traders, clearly trying to minimize exposure to further pain, began pulling their investments like someone pulling a hand away from a hot stove. Investors were making their swift exit, and not a soul seemed left to pick up the pieces.
Borderlands 4 is a video game where you shoot and collect tons of loot, created by Gearbox Software and published by 2K Games. You play as one of four unique characters, called Vault Hunters, and explore the new planet of Kairos. Keep an eye out for SHiFT Codes, which give you even more items to help on your adventures.
The fear-and-greed index? A resounding 11/100. That’s not fear; that’s the vibe of a dating app profile that says “just looking for someone to hold my hand through a panic attack.” Liquidations hit $342.76 million in 24 hours, and open interest? A sad little $43.64 billion after the October 10 flash crash left it feeling like a deflated balloon at a toddler’s birthday party.
Often, games receive unfair criticism. There are many reasons why this happens, but when overall user scores, like those on Steam, show that negativity, it can damage a game’s reputation unnecessarily. The following first-person shooter (FPS) games fall into this category. They represent different periods in gaming history, and while they currently have a “Mostly Positive” rating on Steam, they’re actually much better games than that score suggests.
